糖心TV

Skip to main content Skip to navigation

ThermoPhyl Users guide

Thermophyl Userguide 

This manual provides a quick working guide to ThermoPhyl, a pattern-matching script that rapidly compares and summarizes the number of matches between a list of candidate assays and designated target and non-target sequences. ThermoPhyl is designed for applications in which a user wishes to specifically and sensitively target a taxonomic group of interest in a complex sample using quantitative-PCR or traditional PCR. The name ThermoPhyl derives from its central goal which is to test thermodynamically optimal PCR assays for phylogenetic sensitivity and specificity to arrive at an assay which is both thermodynamically and phylogenetically optimal. In the past, users have typically designed PCR primers and/or probes manually, by visual comparison against multiple alignment files. Even when a phylogenetically suitable assay (i.e. maximally sensitive and specific) can be determined, empirical tests are laborious and often produce poor PCR results.

ThermoPhyl turns this process around by starting with candidate assays which should all produce an efficient PCR. ThermoPhyl is designed to use as input a very large number of candidate assays and assess each one for phylogenetic sensitivity and specificity. The outputs are summary tables of the number of matches to sequences designated as target and non-target groups by the user.

Installing and Running ThermoPhyl

Before ThermoPhyl can be run, PERL must be installed. A is available.

To install ThermoPhyl, the program file simply needs to be copied into the PERL directory or, if PERL is added to the computer鈥檚 path, any directory of choice.

To run ThermoPhyl, just execute the script whether in a Unix or Windows environment. In Windows, double-click on the file, or call up a command window (Start->Run->鈥檆md鈥), navigate to the directory where you have copied ThermoPhyl (for example, 鈥榗d C:\PERL鈥) and type the filename to start the program.

ThermoPhyl requires three input files:

  1. A fasta file which contains all of the target and non-target sequences you wish to test (has to be called 鈥渙utside_world.fas鈥). The more sequences this file contains, the higher the confidence in distinguishing between target and non-target groups. This file can contain the users own sequences and/or sequences retrieved from public databases. Typically, this file might contain 100 鈥 50,000 sequences. Be aware that many databases such as GreenGenes and Silva for 16S rRNA genes contain many very similar sequences; users will generally want to reduce these databases to some sort of core set of representative sequences.

  1. A text file containing only the names of target sequences (has to be called 鈥渢arget_list.txt鈥). The names must correspond to those in the fasta file above and should be some sort of unique identifier, like a GenBank Accession number or GreenGenesID. A column heading can be present or not.

  1. A list of candidate assays for traditional PCR or qPCR (has to be called 鈥渃andidate_assays.txt鈥). The recommended approach is to first compile all target sequences in a single fasta file. For traditional PCR, this file can be read directly into BatchPrimer3 () or for qPCR, each sequence can be input into ABI鈥檚 PrimerExpress to generate a list of candidate assays to test. We typically generate 50 candidate assays per target sequence. All possible candidate assays should be compiled into a single tab-delimited text file (.txt) with columns in the order of Forward Primer, Probe (if present), Reverse Primer, with or without column headings. The file can contain >10,000 candidate assays and should look like this:

 

FORWARD PROBE REVERSE

TGATTGACCACACCCGTATTACC GCCGTTCACCTCAGCCTTAG ATCTCTGCTTGTCCGCTC

CGCTGTTCATGCTTCCGATA GATCGATCATCGGCGGTTT CCTCGGTGTGCATCG

 

Or like this for Primer3 output:

TGATTGACCACACCCGTATTACC

ATCTCTGCTTGTCCGCTC

CGCTGTTCATGCTTCCGATA

CCTCGGTGTGCATCG

 

In the last example of output, the 1st sequence in the list is a forward primer, the 2nd the matching reverse primer, and so on. Each line should have only a line return (paragraph mark) at the end and in the case of multiple columns, each column should be tab-delimited.

Specific Recommendations and Potential Pitfalls:

Cartoon Tree
  1. Target groups should form some sort of natural phylogenetic group. Sequences should be properly placed in some sort of a phylogenetic tree to evaluate this and to designate target and non-target sequences in a way which reflects the evolutionary history of the genetic locus or loci in question. In the cartoon to the left, sensitive and specific assays could probably be designed to successfully distinguish between sequences in the red clade and other, non-target, taxa in the rest of the tree. If your target sequences do not form a coherent phylogenetic group, it will obviously be difficult to design an accurate assay, although it is possible that different sequence data (i.e. different portions of the same alignment or another locus) for the same taxa could still be used in such a case.

  2. The more sequence data available for both target and non-target groups, the better. The strength of ThermoPhyl, in fact its central goal, is to summarize a very large number of comparisons to arrive at a single 鈥榖est鈥 assay. Particularly with environmental samples, we almost always have an incomplete knowledge base, and so may be blind to the best assay.

  3. Files must be in the formats described above. Common problems are listed in the FAQ.

 

Let us know you agree to cookies